ASSIGNMENT TASK:

to write a full lab report about the experiments and pooled data from Project 3 –
Analysis of Two Loci in the Foundations of Biology Class.
Your report should include the following sections (in this order):
• Title page
• Introduction
• Materials and Methods
• Results
• Discussion (that includes relating class data to published experiments performed by researchers from other universities)

DETAILS OF THE ASSIGNMENT:

Before you write:
• Re-read the laboratory exercises that made up Project 3 – Wet Lab 1, Wet Lab 2, Dry Lab 1
(Introduction & Part I) and Dry Lab 2 (Part I). Recall that this semester we added a new locus (CYP1A2 for caffeine metabolism) that is not described in the lab manual, but is presented in the
lab PPT slides. Ask yourself the following questions:
 Which two loci did our class investigate in Project 3?
 What was/were the objective(s) of Project 3?
 What procedures did you perform during Wet Lab 1 and Wet Lab 2 to accomplish the objective(s)?
 What data were collected? (Consider this both for your lab group and for the entire class.)
• Begin writing your report as soon as possible to allow sufficient time to thoughtfully construct and revise your report before you submit a final draft for grading. For most students, writing a full lab
report will require at least 10 hours of writing time (includes generation of figures and tables).
• You can begin writing the Materials and Methods section before you have all the pooled data from the class. This is often the most straightforward section to write and easiest to start with.
Also obtain and read the scientific articles posted in the ICON Lab Materials: Sachse et al., 1999 and Wooding, 2006. These papers provide valuable background information about both genetic
loci that our class investigated.
• Excellent general advice (as well as examples of each section) are presented in Chapter 4 of A Student Handbook for Writing in Biology by Karin Knisely.
• Please read the specific instructions that follow below.
Section-by-section Instructions and Point Breakdown [Total Points = 120]
• Title Page = 4 pts.
 Give your report a concise, but descriptive title that informs a reader of the focus of the report. Do not give the report a generic title such as Project 3 or the title of the lab exercise.
2
 The title page should be separate from the body of the report and include: Your Name, Lab
Section, Team Members, Date
• Introduction = 24 pts. (2 pages maximum)
Although this is the first section of a lab report, often it is easier to save the writing of this section
until after you have written the Materials & Methods and Results sections.
Your introduction should be structured from broad to more specific. Begin by introducing the
broad biological topic to the reader. As you write more of the introduction, narrow the focus to the
specific objectives or question(s) that your experiments addressed. Your introduction also should
provide sufficient and relevant background information (drawn from the lab manual or primary
literature sources) for a reader who is not in the class to understand the topic, specific objectives
and experiments that you go on to describe.
Include these components in your Introduction:
 Broad biological topic
 Specific objectives of the experiments
 Relevant background information about the loci investigated
 Hypothesis(es) tested – include the scientific basis for your hypothesis
 General experimental approach/techniques used to achieve the objectives
• Materials and Methods Section = 24 pts. (2 pages maximum)
This section describes the main techniques and procedures used to accomplish the objectives. It
should provide enough technical detail to allow a person with appropriate background and
training to repeat the experiments described. Do not write this section as a series of steps like in
the lab manual, but as concise paragraphs.
This section should include descriptions of:
 template DNA source and DNA extraction method
 primer sequences (and their concentrations) for PCR of both target loci (see below)
 program used for PCR amplification of target loci (# of cycles and conditions for each)
 restriction enzyme and digestion conditions used for genotype determination by RFLP
analysis
 agarose gel percentage, electrophoresis conditions, and gel staining
 formulas and statistical test(s) used to analyze pooled genotype data for the class
Primer & Thermocycler Program Information:
The concentration of the F and R primers in the T and P primer mixes was 500 nM (for each).
CYP1A2 locus – the primer sequences are given in the 5’3’ direction. The “F” and “R”
primers flank the region that includes the intron 1 A/C polymorphism.
Primer Name: CYP-F
Primer Sequence: 5’GAGAGCGATGGGGAGGGC3’
Primer Name: CYP-R
Primer Sequence: 5’CCCTTGAGACCCAGAATACC3’
Thermocycler Program:
94C for 5m (1 cycle)
94C for 30s, 58C for 30s, 68C for 1 min (35 cycles)
Polish at 68C for 5m (1 cycle)
3
TAS2R38 locus primers – these are the primers that are underlined in Figure 3, p. 164 of the
lab manual. The “R” primer is the “reverse complement” of the sequence in Figure 3.
Primer Name: TAS2R38F
Primer Sequence: 5’AACTGGCAGATTAAAGATCTCAATTTAT3’
Primer Name: TAS2R38R
Primer Sequence: 5’AACACAAACCATCACCCCTATTTT3’
Thermocycler Program: as in lab manual
 Do not describe routine lab procedures and safety practices that all experienced students should know. See the writing handbook for examples of what is not necessary to include in the Material and Methods.
 Do include brief descriptions of the formulas and statistical tests that you utilized to analyze the class data:
 Formulas for calculating class allele frequencies
 Formula(s) for calculating expected genotype frequencies for the class
 Chi-square test or other statistical tests

• Wherever you paraphrase a procedure from the lab manual, cite the manual.
• It would be helpful to look at examples of published research papers (such as the article by Sachse et al., 1999) to see what types of information authors include and how they write the methods section.
• Results = 24 pts. (3 pages maximum, including gel figures and data tables)
This section should summarize the key findings of your experiments for each genetic locus.
Make sure that each summary has sufficient information about the experiment for the reader to understand what is being presented. For example, tell the reader which genetic locus you are describing, what you expected to see in a gel for the different genotypes, and then summarize the actual results in several sentences.
• Include the following components:
 Gel photos presented as numbered figures. For each gel, make sure that gel lanes and DNA size ladder are labeled, and provide a description of the gel contents in an accompanying figure legend.
 In accompanying text, interpret the genotypes for both loci for all members of your group.
 Pooled “genotype” data for both loci (your TA will inform you of which pooled “genotype” data to include in your report). Present the data in one or two labeled tables. Also include the calculated allele frequencies from the observed genotype frequencies.
 Compare the calculated allele frequencies from the gel data to the estimated frequencies that you calculated from the reported phenotypes (self-reported caffeine metabolism and PTC tasting phenotypes).
 Chi-square analysis (with P value) for pooled data to determine whether the observed # of each genotype fit with expectations of HW theory.
 Description of anything that was a problem with the experiment that may have affected interpretation of the data. Present this in the text portion of the Results if and where it is applicable.
• Avoid non-informative statements like “as you can see, the experiment worked. All students had PCR products.”
• Discussion Section = 24 pts. (2 pages maximum)
The Discussion is the section of the lab report where you interpret and draw conclusions from the
pooled data that you presented in the Results section. Do not use your team data as the basis for
drawing conclusions about the class; use the pooled data for the entire class.
Include the following components in your Discussion.
 Restate the project objectives and hypothesis(es).
 Briefly recap the results.
 Interpret the results with respect to the hypothesis(es). State whether the hypothesis was
supported for both, just one, or neither of the two loci.
 Explain the results from an evolutionary perspective; consider the evolutionary forces that
can affect genetic structure (genotype frequencies) in a population over the short term or long
term.** Also consider whether you would expect the same or different findings for the two
loci that you investigated.
 Explain the broader significance of your findings and relate it to what has been previously published on the same topic.